grina

Ensembl ID:
ENSDARG00000052746
ZFIN IDs:
ZDB-GENE-040426-1367, ZDB-GENE-040426-1367
Description:
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) [Sour
Human Orthologue:
GRINA
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) [Sourc
Mouse Orthologue:
Grina
Mouse Description:
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) Gene [

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36273 Essential Splice Site Mutation detected in F1 DNA During 2017
sa28759 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074653 Essential Splice Site 93 337 2 7
ENSDART00000074655 Essential Splice Site 93 328 2 9
ENSDART00000074653 Essential Splice Site 93 337 2 7
ENSDART00000074655 Essential Splice Site 93 328 2 9
Genomic Location (Zv9):
Chromosome 16 (position 57026270)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53608835
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCCGCTCCATACAGCACAGATCCATACTCACAGCCGTTTCCCAACGG[T/C]AAGAGTACTGCTTCACACAGGTGGGCCTGACAAACCACCTGTAGACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074653 Essential Splice Site 93 337 2 7
ENSDART00000074655 Essential Splice Site 93 328 2 9
ENSDART00000074653 Essential Splice Site 93 337 2 7
ENSDART00000074655 Essential Splice Site 93 328 2 9
Genomic Location (Zv9):
Chromosome 16 (position 57026270)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 53608835
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCCGCTCCATACAGCACAGATCCATACTCACAGCCGTTTCCCAACGG[T/C]AAGAGTACTGCTTCACACAGGTGGGCCTGACAAACCACCTGTAGACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link