CARD11

Ensembl ID:
ENSDARG00000052741
Description:
caspase recruitment domain family, member 11 [Source:HGNC Symbol;Acc:16393]
Human Orthologue:
CARD11
Human Description:
caspase recruitment domain family, member 11 [Source:HGNC Symbol;Acc:16393]
Mouse Orthologue:
Card11
Mouse Description:
caspase recruitment domain family, member 11 Gene [Source:MGI Symbol;Acc:MGI:1916978]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20104 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa6912 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3429 Nonsense Mutation detected in F1 DNA During 2014
sa11885 Nonsense Available for shipment Available now
sa9530 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074647 Splice Site, Nonsense 332 1122 6 23
Genomic Location:
Chromosome 3 (position 41595747)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTGTGATGGGTTTAAATGAGCATCATTTAATCTAATAATGCACAGTA[C/A]CTGGAAGAGAAGGAGGACCTTGAGTTGAAGTGCTCCACTTTAGTGAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074647 Essential Splice Site 438 1122 7 23
Genomic Location:
Chromosome 3 (position 41596165)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGGAGTGCAAATTGAGAAGGATGGCTAAGGAAAATGGGTTGGATCAGG[T/C]GAGAAATGAWCTGTGTGATTTAAAAGTTGTTGCTTTTTGCTTAAYTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074647 Nonsense 817 1122 17 23
Genomic Location:
Chromosome 3 (position 41610177)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAGAAGCTGTTAAGTGAACTTAGCTGTCACCTCCTCCCCAGAGCCCAG[C/T]AGCTCCTCTTGGTGAAGATTCAGAAGCTGATGTGTCGAGGAGGCCGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074647 Nonsense 829 1122 17 23
Genomic Location:
Chromosome 3 (position 41610213)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCAGAGCCCAGYAGCTCCTCTTGGTGAAGATTCAGAAGCTGATGTGT[C/T]GAGGAGGCCGAGAAGATGTCGACACTCTGAGAGTGATCCGGGTCAGTTYC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074647 Nonsense 994 1122 21 23
Genomic Location:
Chromosome 3 (position 41619710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGACAAAAGATGAATTCCTCATGAAACAGAAGATAGAGCCCATCATTTA[T/A]TCCAAAGAAAAGCAGGCGGGCACGTATGAATGCATCACCCCAGAAAATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7r3tp64k