egf

Ensembl ID:
ENSDARG00000052739
ZFIN ID:
ZDB-GENE-070922-1
Description:
pro-epidermal growth factor [Source:RefSeq peptide;Acc:NP_991294]
Human Orthologue:
EGF
Human Description:
epidermal growth factor [Source:HGNC Symbol;Acc:3229]
Mouse Orthologue:
Egf
Mouse Description:
epidermal growth factor Gene [Source:MGI Symbol;Acc:MGI:95290]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13676 Nonsense Available for shipment Available now
sa14990 Nonsense Available for shipment Available now
sa24964 Nonsense Mutation detected in F1 DNA During 2014
sa22523 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074639 Nonsense 25 1114 1 23
ENSDART00000126178 Nonsense 88 1177 2 24
Genomic Location:
Chromosome 14 (position 37540558)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAGAATCGTTTCYAGGGCGGGAAGGTCCATTTTGTTGGACTTTCACT[T/A]AAGTGAGTGGACRATGTTTTGGGCGGACACACAAACAGGACAAATCAGMA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074639 Nonsense 177 1114 3 23
ENSDART00000126178 Nonsense 240 1177 4 24
Genomic Location:
Chromosome 14 (position 37538242)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGCAAGGCCAAAGAGGACACACTGCTATGGGCTCCTGCAACTATGAT[G/T]GAAACATTATCAATGTCTTTAATCAGCAATTCAGGTATAACTGAGATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074639 Nonsense 869 1114 18 23
ENSDART00000126178 Nonsense 932 1177 19 24
Genomic Location:
Chromosome 14 (position 37506750)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTAAACGCTGAATGTTTAAATGCCGTAGGAGAATATCAATGTAGATGC[C/T]GATCTGGCTTCACAGGCACTGGTTTCAGCTGTCAAGGTAAGATTTAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22523
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074639 Nonsense 1027 1114 22 23
ENSDART00000126178 Nonsense 1090 1177 23 24
Genomic Location:
Chromosome 14 (position 37501781)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTGTTGGGGATTTTGTGCATTGACACATTATGTGTATGCAGGTCTA[T/A]GTAGTTTTGGACACTTCTACTTGCACTGCTGATAAGGTCCTTCATGTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x56ttb5y