hmgcra

Ensembl ID:
ENSDARG00000052734
ZFIN ID:
ZDB-GENE-040401-2
Description:
3-hydroxy-3-methylglutaryl-Coenzyme A reductase a [Source:RefSeq peptide;Acc:NP_001073446]
Human Orthologue:
HMGCR
Human Description:
3-hydroxy-3-methylglutaryl-CoA reductase [Source:HGNC Symbol;Acc:5006]
Mouse Orthologue:
Hmgcr
Mouse Description:
3-hydroxy-3-methylglutaryl-Coenzyme A reductase Gene [Source:MGI Symbol;Acc:MGI:96159]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16920 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097460 Nonsense 810 884 18 20
Genomic Location:
Chromosome 5 (position 52662460)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCCTCCATTGAGCTGGGCACTGTGGGTGGAGGCACYAACCTTCCTCCT[C/T]AACAGGCCTGTTTAAAGGTAYTTCCGCTGRATTTGGGATGATTAACTCNA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • LDL cholesterol: Common SNPs in HMGCR in micronesians and whites associated with LDL-cholesterol levels affect alternative splicing of exon13. (View Study)
  • Quantitative traits: Genome-wide association studies in an isolated founder population from the Pacific Island of Kosrae. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
  • Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
  • Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)
  • Triglycerides: Large-scale genome-wide association studies in East Asians identify new genetic loci influencing metabolic traits. (View Study)
  • Triglycerides: Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. (View Study)
  • Triglycerides: Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ov9onchr