hmgcra

Ensembl ID:
ENSDARG00000052734
ZFIN ID:
ZDB-GENE-040401-2
Description:
3-hydroxy-3-methylglutaryl-Coenzyme A reductase a [Source:RefSeq peptide;Acc:NP_001073446]
Human Orthologue:
HMGCR
Human Description:
3-hydroxy-3-methylglutaryl-CoA reductase [Source:HGNC Symbol;Acc:5006]
Mouse Orthologue:
Hmgcr
Mouse Description:
3-hydroxy-3-methylglutaryl-Coenzyme A reductase Gene [Source:MGI Symbol;Acc:MGI:96159]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33709 Nonsense Mutation detected in F1 DNA During 2016
sa40555 Nonsense Mutation detected in F1 DNA During 2016
sa33708 Nonsense Mutation detected in F1 DNA During 2016
sa16920 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097460 Nonsense 189 884 7 20
Genomic Location (Zv9):
Chromosome 5 (position 52674375)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50341571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACCAACATTAAACAAATAGTGAATTTTATTTTCTTGCAGGTGTGCGA[C/T]AGCTCGAGATCATGTGCTGCTTTGGTTGCATGTCTGTCTTGGCCAACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40555
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097460 Nonsense 364 884 10 20
Genomic Location (Zv9):
Chromosome 5 (position 52671620)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50338816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCTGTCCCTTAAAGTGCCCACTCCAAGCTCCATGCTCACTCAGAAAT[G/A]GTCTCCGGATCAATGCTGCAGGAAAGAAATCCCCTATTCCACCAAGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33708
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097460 Nonsense 684 884 16 20
Genomic Location (Zv9):
Chromosome 5 (position 52664894)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50332090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGAGGAATTTCCAGAGCTCCAGGTTTTGGCTGTTAGTGGAAATTACTG[T/A]ACTGACAAAAAACCTGCCGCCATCAACTGGATTGAGGGAAGGGGCAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097460 Nonsense 810 884 18 20
Genomic Location (Zv9):
Chromosome 5 (position 52662460)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 50329656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCCTCCATTGAGCTGGGCACTGTGGGTGGAGGCACYAACCTTCCTCCT[C/T]AACAGGCCTGTTTAAAGGTAYTTCCGCTGRATTTGGGATGATTAACTCNA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • LDL cholesterol: Common SNPs in HMGCR in micronesians and whites associated with LDL-cholesterol levels affect alternative splicing of exon13. (View Study)
  • Quantitative traits: Genome-wide association studies in an isolated founder population from the Pacific Island of Kosrae. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
  • Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
  • Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)
  • Triglycerides: Large-scale genome-wide association studies in East Asians identify new genetic loci influencing metabolic traits. (View Study)
  • Triglycerides: Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. (View Study)
  • Triglycerides: Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link