lrrtm1

Ensembl ID:
ENSDARG00000052713
ZFIN ID:
ZDB-GENE-050506-80
Description:
Leucine rich repeat transmembrane neuronal 1 [Source:UniProtKB/TrEMBL;Acc:B8JKM0]
Human Orthologue:
LRRTM1
Human Description:
leucine rich repeat transmembrane neuronal 1 [Source:HGNC Symbol;Acc:19408]
Mouse Orthologue:
Lrrtm1
Mouse Description:
leucine rich repeat transmembrane neuronal 1 Gene [Source:MGI Symbol;Acc:MGI:2389173]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15349 Nonsense Available for shipment Available now
sa16451 Nonsense Available for shipment Available now
sa12867 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074618 Nonsense 146 522 1 1
ENSDART00000133917 Nonsense 148 524 1 1
ENSDART00000074618 Nonsense 146 522 1 1
ENSDART00000133917 Nonsense 148 524 1 1
Genomic Location:
Chromosome 1 (position 43160593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGGGACCTTYAGRCCTCTGCCCAATCTGCGAATAYTGGATTTATCCTA[T/G]AACAGACTTCAGTCCTTGGAGCCAGACCTTTTCCATGGCCTTAGGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16451
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074618 Nonsense 146 522 1 1
ENSDART00000133917 Nonsense 148 524 1 1
ENSDART00000074618 Nonsense 146 522 1 1
ENSDART00000133917 Nonsense 148 524 1 1
Genomic Location:
Chromosome 1 (position 43160593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGGGACCTTYAGRCCTCTGCCCAATCTGCGAATAYTGGATTTATCCTA[T/A]AACAGACTTCAGTCCTTGGAGCCAGACCTTTTCCATGGCCTTAGGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12867
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074618 Nonsense 395 522 1 1
ENSDART00000133917 Nonsense 397 524 1 1
Genomic Location:
Chromosome 1 (position 43159846)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARAAACCGACCCAGAGGCTTCATATATGAGGGCCCAMYAAAAAATCCCTA[C/A]GACCYRCAGGATATGGAGGGTGGGGAAGTGGTGACCAACTCCTTAACAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/upjc37hw