tnni1b

Ensembl ID:
ENSDARG00000052708
ZFIN IDs:
ZDB-GENE-041212-37, ZDB-GENE-041212-37
Description:
troponin I, skeletal, slow b [Source:RefSeq peptide;Acc:NP_001008613]
Human Orthologue:
TNNI1
Human Description:
troponin I type 1 (skeletal, slow) [Source:HGNC Symbol;Acc:11945]
Mouse Orthologue:
Tnni1
Mouse Description:
troponin I, skeletal, slow 1 Gene [Source:MGI Symbol;Acc:MGI:105073]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17057 Nonsense Available for shipment Available now
sa9762 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17057
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007498 Nonsense 80 182 5 8
ENSDART00000130821 Nonsense 80 182 5 8
Genomic Location:
Chromosome 6 (position 54787801)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGCTGTGTCGAGAACTACATGCTAAAATCGATGTGGTGGATGAAGAG[C/T]GATACGACATTGAGGCGAAAGTACTTCACAACACAAGAGAARTAAAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007498 Essential Splice Site 93 182 5 8
ENSDART00000130821 Essential Splice Site 93 182 5 8
Genomic Location:
Chromosome 6 (position 54787759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAAGAGCGATACGACATTGAGGCGAAAGTACTTCACAACACAAGAGAA[G/A]TAAAGCAACGGTTTAACCATTTATACAATATATGCTATCAACAAYGCAKC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iohjbfny