tnni1b

Ensembl ID:
ENSDARG00000052708
ZFIN IDs:
ZDB-GENE-041212-37, ZDB-GENE-041212-37
Description:
troponin I, skeletal, slow b [Source:RefSeq peptide;Acc:NP_001008613]
Human Orthologue:
TNNI1
Human Description:
troponin I type 1 (skeletal, slow) [Source:HGNC Symbol;Acc:11945]
Mouse Orthologue:
Tnni1
Mouse Description:
troponin I, skeletal, slow 1 Gene [Source:MGI Symbol;Acc:MGI:105073]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17057 Nonsense Available for shipment Available now
sa9762 Essential Splice Site Available for shipment Available now
sa33979 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17057
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007498 Nonsense 80 182 5 8
ENSDART00000130821 Nonsense 80 182 5 8
Genomic Location:
Chromosome 6 (position 54787801)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGCTGTGTCGAGAACTACATGCTAAAATCGATGTGGTGGATGAAGAG[C/T]GATACGACATTGAGGCGAAAGTACTTCACAACACAAGAGAARTAAAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007498 Essential Splice Site 93 182 5 8
ENSDART00000130821 Essential Splice Site 93 182 5 8
Genomic Location:
Chromosome 6 (position 54787759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAAGAGCGATACGACATTGAGGCGAAAGTACTTCACAACACAAGAGAA[G/A]TAAAGCAACGGTTTAACCATTTATACAATATATGCTATCAACAAYGCAKC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007498 Essential Splice Site None 182 7 8
ENSDART00000130821 Essential Splice Site None 182 7 8
Genomic Location:
Chromosome 6 (position 54780944)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGTTTGATGCAGCACAATAAACATCTGATCAAAATCAGCACCTGCGA[G/A]TATGCAAATGAATACTAGCATATGCTCAAAACTTTATTTACTAAGGTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link