pkp1

Ensembl ID:
ENSDARG00000052705
ZFIN ID:
ZDB-GENE-030131-417
Human Orthologue:
PKP1
Human Description:
plakophilin 1 (ectodermal dysplasia/skin fragility syndrome) [Source:HGNC Symbol;Acc:9023]
Mouse Orthologue:
Pkp1
Mouse Description:
plakophilin 1 Gene [Source:MGI Symbol;Acc:MGI:1328359]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40802 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40802
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074605 Nonsense 643 736 11 13
Genomic Location (Zv9):
Chromosome 6 (position 54703172)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54739906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGGTTTCCTGAACTCTGGTCTTTCCAAGAAAGAATCTTCTCCTGAATA[T/G]GACAGTGCGATGGCCACCGCTCTGCGCAGCGCAAACACTCTGATTAATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link