cisd2

Ensembl ID:
ENSDARG00000052703
ZFIN ID:
ZDB-GENE-040426-1381
Description:
CDGSH iron-sulfur domain-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q7T326]
Human Orthologue:
CISD2
Human Description:
CDGSH iron sulfur domain 2 [Source:HGNC Symbol;Acc:24212]
Mouse Orthologue:
Cisd2
Mouse Description:
CDGSH iron sulfur domain 2 Gene [Source:MGI Symbol;Acc:MGI:1914256]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1385 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa1385
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074604 None None 135 None 3
ENSDART00000137791 Nonsense 116 125 2 2
Genomic Location:
Chromosome 1 (position 44070810)
KASP Assay ID:
554-1297.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTGCTGGCGATCTAAAACGGTAGGAGGAAAGAAAAAAACAGCATTTTA[T/A]ACAAATAAAGCACCTGATCTAGATGGGTAATATCATGAGAACTTGTGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/avzjx53c