capn1a

Ensembl ID:
ENSDARG00000052702
ZFIN ID:
ZDB-GENE-040426-1263
Description:
calpain 1, (mu/I) large subunit a [Source:RefSeq peptide;Acc:NP_956739]
Human Orthologue:
CAPN1
Human Description:
calpain 1, (mu/I) large subunit [Source:HGNC Symbol;Acc:1476]
Mouse Orthologue:
Capn1
Mouse Description:
calpain 1 Gene [Source:MGI Symbol;Acc:MGI:88263]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2687 Nonsense F2 line generated During 2016
sa4531 Nonsense Mutation detected in F1 DNA During 2016
sa42288 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2687
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046066 Nonsense 229 704 6 22
Genomic Location:
Chromosome 13 (position 43355779)
KASP Assay ID:
554-2682.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCGTTTCAGARATGTACGAGCTCCGGAAAGCTCCMAGAGACTTGTAC[C/T]GAATCATCAGCAAAGCCCTGGACAGAGGCTCMCTGCTGGGCTGCTCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046066 Nonsense 277 704 8 22
Genomic Location:
Chromosome 13 (position 43351950)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGTCCGANNNATGTGCAATATCTTTATCCGSTTTGACAGGTGGAGTA[C/A]AGGGGGCGGATGGAGAGGCTTATCCGCATCCGTAATCCWTGGGGTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046066 Nonsense 390 704 11 22
Genomic Location:
Chromosome 13 (position 43346042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTTCCTGTGCTGTTTTTCAGACACGTTCTGGATCAATCCACAGTA[T/G]AAGATCACACTGCTGGAGGAAGATGATGATCCGGAGGATGAAGAAGTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link