capn1a

Ensembl ID:
ENSDARG00000052702
ZFIN ID:
ZDB-GENE-040426-1263
Description:
calpain 1, (mu/I) large subunit a [Source:RefSeq peptide;Acc:NP_956739]
Human Orthologue:
CAPN1
Human Description:
calpain 1, (mu/I) large subunit [Source:HGNC Symbol;Acc:1476]
Mouse Orthologue:
Capn1
Mouse Description:
calpain 1 Gene [Source:MGI Symbol;Acc:MGI:88263]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2687 Nonsense F2 line generated During 2014
sa4531 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2687
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046066 Nonsense 229 704 6 22
Genomic Location:
Chromosome 13 (position 43355779)
KASP Assay ID:
554-2682.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCGTTTCAGARATGTACGAGCTCCGGAAAGCTCCMAGAGACTTGTAC[C/T]GAATCATCAGCAAAGCCCTGGACAGAGGCTCMCTGCTGGGCTGCTCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046066 Nonsense 277 704 8 22
Genomic Location:
Chromosome 13 (position 43351950)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGTCCGANNNATGTGCAATATCTTTATCCGSTTTGACAGGTGGAGTA[C/A]AGGGGGCGGATGGAGAGGCTTATCCGCATCCGTAATCCWTGGGGTCAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/84g52g2y