capn1a

Ensembl ID:
ENSDARG00000052702
ZFIN ID:
ZDB-GENE-040426-1263
Description:
calpain 1, (mu/I) large subunit a [Source:RefSeq peptide;Acc:NP_956739]
Human Orthologue:
CAPN1
Human Description:
calpain 1, (mu/I) large subunit [Source:HGNC Symbol;Acc:1476]
Mouse Orthologue:
Capn1
Mouse Description:
calpain 1 Gene [Source:MGI Symbol;Acc:MGI:88263]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2687 Nonsense F2 line generated During 2016
sa42288 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa2687
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046066 Nonsense 229 704 6 22
Genomic Location (Zv9):
Chromosome 13 (position 43355779)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42576738
KASP Assay ID:
554-2682.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCGTTTCAGARATGTACGAGCTCCGGAAAGCTCCMAGAGACTTGTAC[C/T]GAATCATCAGCAAAGCCCTGGACAGAGGCTCMCTGCTGGGCTGCTCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046066 Nonsense 390 704 11 22
Genomic Location (Zv9):
Chromosome 13 (position 43346042)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42567001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTTCCTGTGCTGTTTTTCAGACACGTTCTGGATCAATCCACAGTA[T/G]AAGATCACACTGCTGGAGGAAGATGATGATCCGGAGGATGAAGAAGTGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link