LOC797914

Ensembl ID:
ENSDARG00000052701
Human Orthologue:
SMPD2
Human Description:
sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) [Source:HGNC Symbol;A
Mouse Orthologue:
Smpd2
Mouse Description:
sphingomyelin phosphodiesterase 2, neutral Gene [Source:MGI Symbol;Acc:MGI:1278330]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5390 Nonsense Mutation detected in F1 DNA During 2014
sa15945 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074602 Nonsense 89 436 4 10
Genomic Location:
Chromosome 6 (position 54645763)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTTTCAGTGGATTTTTTGGGAGCGGACTTGCTGTGTTTTCAAGACAT[C/T]AAATCCATGATGCCTTTCTCTACAGATACTCTTTGAAYGGATATCCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15945
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074602 Nonsense 367 436 10 10
Genomic Location:
Chromosome 6 (position 54657236)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTTGTTTGCTCTKGGAGCCGAACAGCCYTTTCCTAAAGCCACCTTCTA[C/A]CTGCTGGGGGCGCTGTGCTTTGCCATCCTGCTCTCCACACTKATGCTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/poc1udda