LOC571064

Ensembl ID:
ENSDARG00000052700
Human Orthologues:
AC134882.1, NHEDC1, NHEDC2
Human Descriptions:
Na+/H+ exchanger domain containing 1 [Source:HGNC Symbol;Acc:24244]
Na+/H+ exchanger domain containing 2 [Source:HGNC Symbol;Acc:25143]
Putative protein NHEDC1-like 1 [Source:UniProtKB/Swiss-Prot;Acc:A6NJY1]
Mouse Orthologues:
Nhedc1, Nhedc2
Mouse Descriptions:
Na+/H+ exchanger domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1921696]
Na+/H+ exchanger domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2140077]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13293 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074600 Nonsense 356 564 8 12
Genomic Location (Zv9):
Chromosome 1 (position 44084186)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43000502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGTTTTTGTTGTTGATTTGTGTGTTTGCGTGCAGAGAAACCTCGTGT[T/A]GAAACGCTCCTTCCTGGTGTTGGGCTTGTCAGTGTTTGCTCTGTTTGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link