bdh2

Ensembl ID:
ENSDARG00000052696
ZFIN ID:
ZDB-GENE-050417-343
Description:
3-hydroxybutyrate dehydrogenase type 2 [Source:UniProtKB/Swiss-Prot;Acc:Q561X9]
Human Orthologue:
BDH2
Human Description:
3-hydroxybutyrate dehydrogenase, type 2 [Source:HGNC Symbol;Acc:32389]
Mouse Orthologue:
Bdh2
Mouse Description:
3-hydroxybutyrate dehydrogenase, type 2 Gene [Source:MGI Symbol;Acc:MGI:1917022]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39664 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2017
sa32733 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39663 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074597 Splice Site None 245 None 10
ENSDART00000132542 Essential Splice Site None 245 1 10
ENSDART00000133715   None 177 None 7

The following transcripts of ENSDARG00000052696 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 44110038)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43026354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGACGTTTGTTCATCACGTGTGTTGTTTTCACTAGTTGTCACTTGTCAG[T/A]AAGTTCTTCTACTGTTTATTGTGTTTTTTCTTCTTGTAAACCGATGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32733
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074597 Essential Splice Site 177 245 7 10
ENSDART00000132542 Essential Splice Site 177 245 7 10
ENSDART00000133715   177 177 7 7

The following transcripts of ENSDARG00000052696 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 44102605)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43018921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGCTGATTTCCTGGAACAAGGCATCCGCTGTAATTGCATCTGCCCAG[G/A]TATGCTAATTCGTTTATCGATTGGTTTCCTCTGTGGACCTTAGATGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074597 Nonsense 211 245 9 10
ENSDART00000132542 Nonsense 211 245 9 10
ENSDART00000133715   None 177 None 7

The following transcripts of ENSDARG00000052696 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 44099588)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43015904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTTTCAGGCTTTTAAAGACTTTATGGCCAGACAGAGGACCGGTCGAT[T/A]GTGCACTGCAGAGGAAGTGGCGCATCTGTGTGTGTACTTGGCTTCAGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link