nr2f1a

Ensembl ID:
ENSDARG00000052695
ZFIN IDs:
ZDB-GENE-000112-36, ZDB-GENE-000112-36, ZDB-GENE-980526-115
Description:
Nuclear receptor subfamily 2 group F member 1-A [Source:UniProtKB/Swiss-Prot;Acc:Q06725]
Human Orthologue:
NR2F1
Human Description:
nuclear receptor subfamily 2, group F, member 1 [Source:HGNC Symbol;Acc:7975]
Mouse Orthologue:
Nr2f1
Mouse Description:
nuclear receptor subfamily 2, group F, member 1 Gene [Source:MGI Symbol;Acc:MGI:1352451]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20527 Nonsense Available for shipment Available now
sa11358 Nonsense Available for shipment Available now
sa40551 Nonsense Mutation detected in F1 DNA During 2017
sa14691 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20527
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051263 Nonsense 72 411 1 3
ENSDART00000133384 Nonsense 72 410 1 3
Genomic Location (Zv9):
Chromosome 5 (position 51528488)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 49094186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAGGGACGGCTGGCGACAAGGGCAGCCAGAATTCTGGACAGAGTCAA[C/T]AGCATATAGAATGTGTTGTTTGCGGGGACAAATCAAGCGGCAAGCACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11358
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051263 Nonsense 93 411 1 3
ENSDART00000133384 Nonsense 93 410 1 3
Genomic Location (Zv9):
Chromosome 5 (position 51528553)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 49094251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTTTGCGGGGACAAAKCAAGCGGCAAGCACTATGGTCAATTCACCTG[C/A]GAAGGAWGCAAAAGTTTCTTCAAGAGGAGTGTCCGAAGGAACTTAACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051263 Nonsense 332 411 3 3
ENSDART00000133384 Nonsense 331 410 3 3
Genomic Location (Zv9):
Chromosome 5 (position 51533111)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 49098809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTTGTCTACTCAGACGCTTGCGGCCTGTCAGATGCTGCACACATC[G/T]AGAGTCTGCAGGAGAAGTCTCAGTGCGCCCTGGAGGAGTACGTGAGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14691
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051263 Nonsense 361 411 3 3
ENSDART00000133384 Nonsense 360 410 3 3
Genomic Location (Zv9):
Chromosome 5 (position 51533199)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 49098897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACRTGAGGAGCCAGTACCCGAACCAGCCCAGTCGCTTTGGCAAGCKTT[T/A]ACTGCGACTGCCTTCTCTCCGCACTGTCTCTTCGTCAGTAATTGAACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link