micall2

Ensembl ID:
ENSDARG00000052694
ZFIN ID:
ZDB-GENE-030131-5409
Description:
mical-like 2 [Source:RefSeq peptide;Acc:NP_963879]
Human Orthologue:
MICAL1
Human Description:
microtubule associated monoxygenase, calponin and LIM domain containing 1 [Source:HGNC Symbol;Acc:20
Mouse Orthologue:
Mical1
Mouse Description:
microtubule associated monoxygenase, calponin and LIM domain containing 1 Gene [Source:MGI Symbol;Ac

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20111 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20111
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134844 Essential Splice Site 596 799 10 17

The following transcripts of ENSDARG00000052694 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 43490685)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAAACTTTCATCTCCAAAACAGCCTCGCTGCGGGTCAGCGACATCAA[G/A]TAAGCATGTTCAAATGGTTATTAAAAATATATATTTTATTTTATGTATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aier2x5u