si:dkey-172m14.3

Ensembl ID:
ENSDARG00000052690
ZFIN IDs:
ZDB-GENE-030131-2913, ZDB-GENE-060526-223
Description:
arrestin domain-containing protein 3 [Source:RefSeq peptide;Acc:NP_001073498]
Human Orthologue:
ARRDC3
Human Description:
arrestin domain containing 3 [Source:HGNC Symbol;Acc:29263]
Mouse Orthologue:
Arrdc3
Mouse Description:
arrestin domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2145242]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6063 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074592 Nonsense 81 414 1 8

The following transcripts of ENSDARG00000052690 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 50778323)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 48344021
KASP Assay ID:
554-3795.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGATCCAGCACTGCCTACACWCAAAATTACACAGAAGAAGTGGAATA[T/G]CTCAATCATAGAGACATCCTAATTGGCCATGAAAGAGGTAAGCATGCCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer (prognosis): Identification of inherited genetic variations influencing prognosis in early-onset breast cancer. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link