si:dkey-182g1.2

Ensembl ID:
ENSDARG00000052680
ZFIN ID:
ZDB-GENE-060503-619
Description:
Si:dkey-182g1.2 protein [Source:UniProtKB/TrEMBL;Acc:A7MBN9]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8926 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106086 Nonsense 87 283 2 6
ENSDART00000140720 Nonsense 87 269 2 5

The following transcripts of ENSDARG00000052680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 8787556)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 8733326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGWATGACACCGATGATGGCAYATTCGCAGGCAAACTACAAGTAAATGAC[A/T]AAACCGGAGATCTCATCATCAGAAATCCCAGACCTAAACACTCRGGGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link