sept7a

Ensembl ID:
ENSDARG00000052673
ZFIN ID:
ZDB-GENE-040426-1008
Description:
LOC100000597 protein [Source:UniProtKB/TrEMBL;Acc:Q4V8R9]
Human Orthologues:
SEPT7, SEPT7L
Human Descriptions:
septin 7 [Source:HGNC Symbol;Acc:1717]
septin 7-like [Source:HGNC Symbol;Acc:30810]
Mouse Orthologue:
Sept7
Mouse Description:
septin 7 Gene [Source:MGI Symbol;Acc:MGI:1335094]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28743 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42820 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074575 Essential Splice Site 50 428 4 14
Genomic Location (Zv9):
Chromosome 16 (position 50625605)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47479680
KASP Assay ID:
2261-0318.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTCAGGTCTTGTTTTAACCTTCTGTGTATTTTCTGCTCTTTTTTTTTC[A/T]GGAGAATCGGGGTTGGGAAAGTCCACACTGATAAATTCTCTGTTCCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074575 Essential Splice Site 326 428 11 14
Genomic Location (Zv9):
Chromosome 16 (position 50610355)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47464430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCACCTGTAACGGCATCGACAACAACAAAGCCAAAGGCCAGCTCACCAA[G/A]TAAGTGGCATTGAGCAACATTGTATTAAAGTATTGAACCATTTCAAATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link