ENSDARG00000052664

Ensembl ID:
ENSDARG00000052664
Human Orthologues:
MSLN, MSLNL
Human Descriptions:
mesothelin [Source:HGNC Symbol;Acc:7371]
mesothelin-like [Source:HGNC Symbol;Acc:14170]
Mouse Orthologues:
Msln, Mslnl
Mouse Descriptions:
mesothelin Gene [Source:MGI Symbol;Acc:MGI:1888992]
mesothelin-like Gene [Source:MGI Symbol;Acc:MGI:3607710]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33286 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa33287 Nonsense Mutation detected in F1 DNA During 2016
sa33288 Essential Splice Site Available for shipment Available now
sa40142 Nonsense Mutation detected in F1 DNA During 2016
sa1405 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074557 Splice Site, Nonsense 114 2048 3 48
Genomic Location (Zv9):
Chromosome 3 (position 42731466)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43177539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCAACATGACACTGAACCTGACCAGCACCAGTTCAGGGCTCCTCGAC[A/T]AGGTTAGATAGGAGTTTTTGACTGATAGATCCAATGATGAAACACCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074557 Nonsense 123 2048 4 48
Genomic Location (Zv9):
Chromosome 3 (position 42731580)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43177425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTGTTTTCATATTTCACTGCAGAATCTCACAGACTTTGTGCAATATT[T/A]GAGACCAATGGGAAGATTCATCAGATCATGTGTGAACATTGCTCAGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074557 Essential Splice Site 480 2048 11 48
Genomic Location (Zv9):
Chromosome 3 (position 42742179)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43166826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGACAAACTCAATAGCTTCCTACCAGCTCTTCAGACACAGGCCAGAAAA[G/A]TGTGTAACAGCAAACTGCTTCATATAATGGAGTCTCAGCAGGCAGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074557 Nonsense 873 2048 23 48
Genomic Location (Zv9):
Chromosome 3 (position 42748028)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43160977
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTGATCTAAATACCGCTAATGGAGAAGTTCTGGTCTGGATTCAGACT[A/T]GACTCCCGCCTCTGTTATCCAACTTTTCAGAAAGCCTTGTGTCTCCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074557 Nonsense 1568 2048 39 48
Genomic Location (Zv9):
Chromosome 3 (position 42762415)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 43146590
KASP Assay ID:
554-1326.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAACAAGCATCCGGAAACAGGATCTGAYAGTGCTGGGCAATTTGGTGTG[T/A]GTTGTGAGCAGTGACTACATTACAAACTCAGATCCAGAAATCCTGGAGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link