ENSDARG00000052664

Ensembl ID:
ENSDARG00000052664
Human Orthologues:
MSLN, MSLNL
Human Descriptions:
mesothelin [Source:HGNC Symbol;Acc:7371]
mesothelin-like [Source:HGNC Symbol;Acc:14170]
Mouse Orthologues:
Msln, Mslnl
Mouse Descriptions:
mesothelin Gene [Source:MGI Symbol;Acc:MGI:1888992]
mesothelin-like Gene [Source:MGI Symbol;Acc:MGI:3607710]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1405 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074557 Nonsense 1568 2048 39 48
Genomic Location:
Chromosome 3 (position 42762415)
KASP Assay ID:
554-1326.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAACAAGCATCCGGAAACAGGATCTGAYAGTGCTGGGCAATTTGGTGTG[T/A]GTTGTGAGCAGTGACTACATTACAAACTCAGATCCAGAAATCCTGGAGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n7unvn6l