si:ch73-22c10.1

Ensembl ID:
ENSDARG00000052652
ZFIN ID:
ZDB-GENE-030131-3264
Human Orthologue:
FERMT1
Human Description:
fermitin family member 1 [Source:HGNC Symbol;Acc:15889]
Mouse Orthologue:
Fermt1
Mouse Description:
fermitin family homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443583]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23801 Essential Splice Site Available for shipment Available now
sa11922 Nonsense Available for shipment Available now
sa37147 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23801
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074546 Essential Splice Site 409 666 9 14
ENSDART00000147637   None 127 None 3
ENSDART00000147897 Essential Splice Site 404 661 10 15

The following transcripts of ENSDARG00000052652 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 45989820)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45883509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAAAGATTCTGCCAATAAAGAGCCCATTGAGCAGCTTCATCTACGAG[G/A]TGAGCAGCCAATCAGAGAGCATGTCATTCACTTCAGTGCATTTGCAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074546 Nonsense 512 666 11 14
ENSDART00000147637   None 127 None 3
ENSDART00000147897 Nonsense 507 661 12 15

The following transcripts of ENSDARG00000052652 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 45986241)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45879930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAWGTAGAGTCCATGGAGATGAACCCCGAGTGCTTTGTTTCTCCRCGATA[T/A]GCTAAGAAGTTYAAGACCAAACAGGTCAGATCACAATCTCAGGACCRGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074546 Nonsense 557 666 12 14
ENSDART00000147637   None 127 None 3
ENSDART00000147897 Nonsense 552 661 13 15

The following transcripts of ENSDARG00000052652 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 45983809)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45877498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAAATGCGTTTCATTCAAGCATGGCAGTCTCTGCCCGATTTTGGCATC[A/T]AGTACTATATTGTCAGGTAATTTTGCTGAATTGTTTAATTGCTATTGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link