ca10a

Ensembl ID:
ENSDARG00000052644
ZFIN IDs:
ZDB-GENE-050419-266, ZDB-GENE-051030-123, ZDB-GENE-051030-123
Description:
carbonic anhydrase-related protein 10 [Source:RefSeq peptide;Acc:NP_001032198]
Human Orthologue:
CA10
Human Description:
carbonic anhydrase X [Source:HGNC Symbol;Acc:1369]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15147 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074540 Essential Splice Site 46 328 3 9
ENSDART00000133188 None None 45 None 2
Genomic Location:
Chromosome 12 (position 22756393)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTATTTGATGAATACTGCAAATCATCCCTTTGTGTTTCATCTTGTTGC[A/G]GTGCCATCATTCTGGGGGCTTGTAAATTCAGCTTGGAATCTGTGTTCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jqtwznks