SHA9B_DANRE

Ensembl ID:
ENSDARG00000052642
Description:
Protein shisa-9B [Source:UniProtKB/Swiss-Prot;Acc:B3DHW5]
Human Orthologues:
SHISA8, SHISA9
Human Descriptions:
shisa homolog 8 (Xenopus laevis) [Source:HGNC Symbol;Acc:18351]
shisa homolog 9 (Xenopus laevis) [Source:HGNC Symbol;Acc:37231]
Mouse Orthologue:
Shisa9
Mouse Description:
shisa homolog 9 (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1919805]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14745 Essential Splice Site Available for shipment Available now
sa12997 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074537 Essential Splice Site 250 433 2 4
Genomic Location (Zv9):
Chromosome 3 (position 46138973)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48148526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACAACCCTACGAAAAYCTGCAGGCCCGAGCAACAGGAAACAACCTGC[G/A]YAAGTAGATCTCCTCACGCACAACAGGTCCAATCCATGTSACTCAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074537 Nonsense 381 433 4 4
Genomic Location (Zv9):
Chromosome 3 (position 46082238)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 48091791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGCTTATGGCTCCAAYACAATCGCCAAYCCCGGCAGGATGAGTAGCT[G/A]GGAGACTACAGAAACACTGGGCCGCCGGCACACGTACGGCCCCAAGAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link