kpna3

Ensembl ID:
ENSDARG00000052641
ZFIN ID:
ZDB-GENE-030616-541
Description:
importin subunit alpha-3 [Source:RefSeq peptide;Acc:NP_958477]
Human Orthologue:
KPNA3
Human Description:
karyopherin alpha 3 (importin alpha 4) [Source:HGNC Symbol;Acc:6396]
Mouse Orthologue:
Kpna3
Mouse Description:
karyopherin (importin) alpha 3 Gene [Source:MGI Symbol;Acc:MGI:1100863]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24854 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9826 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074519 Essential Splice Site 128 520 7 17
Genomic Location:
Chromosome 1 (position 47175684)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCGTTGCCTTAAACATACCAACTTCTATTTCTCTCTCCTTCTTCATC[A/G]GTCCTTCATTGCAGTTTGAAGCTGCCTGGGCTTTGACTAACATTGCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9826
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074519 Nonsense 241 520 9 17
Genomic Location:
Chromosome 1 (position 47172853)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCAACCTGTGCCGAAACAAAGACCCTCCACCACCCATGGAAACAGTA[C/T]AAGAGGTGAGCAAAGTGTGTGAYCCCTGTTTGTGCATTTCTGACTCGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8gnp3ka2