si:ch211-106n13.3

Ensembl ID:
ENSDARG00000052633
ZFIN ID:
ZDB-GENE-030131-9088
Description:
hypothetical protein LOC563353 [Source:RefSeq peptide;Acc:NP_001038479]
Human Orthologue:
COL21A1
Human Description:
collagen, type XXI, alpha 1 [Source:HGNC Symbol;Acc:17025]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15157 Nonsense Available for shipment Available now
sa39942 Nonsense Mutation detected in F1 DNA During 2017
sa33044 Nonsense Mutation detected in F1 DNA During 2017
sa14259 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083654 Nonsense 567 873 14 24
ENSDART00000140294   None 195 None 5
Genomic Location (Zv9):
Chromosome 2 (position 50589056)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50284588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TKGGATTCAAAACTGTACTTAAAGTGTGTSTTTGTGGTTTTAGGGTAWAC[G/T]AGGGCTTCCTGGAGAGATGGGGCCTGCWGGAGCTCAAGTAAGAACCYARA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083654 Nonsense 645 873 18 24
ENSDART00000140294   None 195 None 5
Genomic Location (Zv9):
Chromosome 2 (position 50571048)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50266580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGGTTAAATGCCATCATTTTATATTTGCAGGGTGAATCCGGATCATTG[G/A]GACCGAAAGGAAGTCAGGTATAGTGTGATCGACATCTGTGACATTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33044
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083654 Nonsense 725 873 22 24
ENSDART00000140294 Nonsense 47 195 3 5
Genomic Location (Zv9):
Chromosome 2 (position 50560418)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50255950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGAACTGTCTCTTTAAGAAGCGATATTCCCTTAACAGCCCAGCTGCCA[C/T]AGCTCCTGCAGGCAATGGAGCAAAGAAGCTGCCAGCACTGTGAGACCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083654 Essential Splice Site 785 873 22 24
ENSDART00000140294 Essential Splice Site 107 195 3 5
Genomic Location (Zv9):
Chromosome 2 (position 50560236)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50255768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGGATATCCAGGACCTCCGGGCAGCAGAGGGCCTGAGGGAGTCAAAGG[T/G]GATTATACTGYGATTATAAATTSACAGGAAGATTAGAGACAAGTACTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link