thbs4a

Ensembl ID:
ENSDARG00000052631
ZFIN ID:
ZDB-GENE-080215-11
Description:
thrombospondin 4a [Source:RefSeq peptide;Acc:NP_001107896]
Human Orthologue:
THBS4
Human Description:
thrombospondin 4 [Source:HGNC Symbol;Acc:11788]
Mouse Orthologue:
Thbs4
Mouse Description:
thrombospondin 4 Gene [Source:MGI Symbol;Acc:MGI:1101779]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20531 Nonsense Mutation detected in F1 DNA During 2014
sa2199 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa20531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051005 Nonsense 517 944 14 22
Genomic Location:
Chromosome 5 (position 54744287)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGATGAGAAGCTTACATAACTGTCTATATTCCTACAGGACAACTGCTG[G/A]CTGACGCCTAACATAGACCAGAAAAACAGTGATAAAGATCTGCATGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2199
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051005 Essential Splice Site 930 944 21 22
Genomic Location:
Chromosome 5 (position 54757325)
KASP Assay ID:
554-2493.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTCACAGGAAAACATAATCTGGTCCAACCTGAGATAYCGCTGTAATG[G/A]TGAGAGCAATGCTTATTGCAATTACKATTGCASCCAGGGTCGAGRCTAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/beu9roib