thbs4a

Ensembl ID:
ENSDARG00000052631
ZFIN ID:
ZDB-GENE-080215-11
Description:
thrombospondin 4a [Source:RefSeq peptide;Acc:NP_001107896]
Human Orthologue:
THBS4
Human Description:
thrombospondin 4 [Source:HGNC Symbol;Acc:11788]
Mouse Orthologue:
Thbs4
Mouse Description:
thrombospondin 4 Gene [Source:MGI Symbol;Acc:MGI:1101779]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20531 Nonsense Mutation detected in F1 DNA During 2016
sa33716 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40558 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2199 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa20531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051005 Nonsense 517 944 14 22
Genomic Location (Zv9):
Chromosome 5 (position 54744287)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51279181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGATGAGAAGCTTACATAACTGTCTATATTCCTACAGGACAACTGCTG[G/A]CTGACGCCTAACATAGACCAGAAAAACAGTGATAAAGATCTGCATGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051005 Essential Splice Site 761 944 19 22
Genomic Location (Zv9):
Chromosome 5 (position 54753497)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51288391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAAAGTGTTGTTGTTGGGATGAGTGATGGAATCTTATCACTCCAAAC[A/T]GGATACACTGCATTCAATGGTGTGGACTTTGAGGGCACCTTTCACGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051005 Essential Splice Site 884 944 21 22
Genomic Location (Zv9):
Chromosome 5 (position 54757184)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51292078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAGTTCACTAAAGTATTATACATATTTAGTCATCTTTGTTTGTTAACA[G/T]GGTGCAGTTCTATGAAGGCACTGACCTGGTAGCAGATTCTGGAGTGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2199
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051005 Essential Splice Site 930 944 21 22
Genomic Location (Zv9):
Chromosome 5 (position 54757325)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51292219
KASP Assay ID:
554-2493.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTCACAGGAAAACATAATCTGGTCCAACCTGAGATAYCGCTGTAATG[G/A]TGAGAGCAATGCTTATTGCAATTACKATTGCASCCAGGGTCGAGRCTAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link