ENSDARG00000052626

Ensembl ID:
ENSDARG00000052626

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa461 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa461
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074501 Nonsense 255 472 4 9
Genomic Location:
Chromosome 12 (position 47146353)
KASP Assay ID:
554-0165.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGTTTAACACTAGCTATACAACTGACATGCCAGAGACGACCACAACA[G/T]AAACTACAATATCTCTTTTCTACATAAATATAAATACCAGGGTCGGTCGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uwp4429c