bsdc1

Ensembl ID:
ENSDARG00000052623
ZFIN ID:
ZDB-GENE-040905-1
Description:
BSD domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A2BIJ3]
Human Orthologue:
BSDC1
Human Description:
BSD domain containing 1 [Source:HGNC Symbol;Acc:25501]
Mouse Orthologue:
Bsdc1
Mouse Description:
BSD domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913466]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35585 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005195 Essential Splice Site 368 412 None 11
ENSDART00000074547 Essential Splice Site 185 229 None 7
Genomic Location (Zv9):
Chromosome 13 (position 46559244)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 45855113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAACTCAGACAGCGGCAAGTCCACACCCTCCAATAATGGCAAAAAAGG[T/G]GAGAGAGACCATATAGAATCTATAGAGAATGGGAATGTGTCGTAACTGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link