ahrrb

Ensembl ID:
ENSDARG00000052618
ZFIN ID:
ZDB-GENE-051018-2
Description:
aryl-hydrocarbon receptor repressor b [Source:RefSeq peptide;Acc:NP_001029092]
Human Orthologue:
AHRR
Human Description:
aryl-hydrocarbon receptor repressor [Source:HGNC Symbol;Acc:346]
Mouse Orthologue:
Ahrr
Mouse Description:
aryl-hydrocarbon receptor repressor Gene [Source:MGI Symbol;Acc:MGI:1333776]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6866 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074511 Nonsense 422 573 8 8
ENSDART00000137704 Nonsense 422 573 8 8
Genomic Location:
Chromosome 2 (position 50704316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TSCAAAATGAAGCTTTTAACACACTCCCCGAAGCYGCCATCAAAACCGAA[C/T]AAGATTCTGACTCTGAAAATGGGTGTAATGCATACRGGATGCTCTGGCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ei288yni