raver1

Ensembl ID:
ENSDARG00000052617
ZFIN ID:
ZDB-GENE-050522-99
Description:
ribonucleoprotein, PTB-binding 1 [Source:RefSeq peptide;Acc:NP_001018503]
Human Orthologue:
RAVER1
Human Description:
ribonucleoprotein, PTB-binding 1 [Source:HGNC Symbol;Acc:30296]
Mouse Orthologue:
Raver1
Mouse Description:
ribonucleoprotein, PTB-binding 1 Gene [Source:MGI Symbol;Acc:MGI:1919016]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20124 Nonsense Mutation detected in F1 DNA During 2014
sa9586 Nonsense Available for shipment Available now
sa9053 Splice Site, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040083 Nonsense 112 312 2 4
ENSDART00000127832 Nonsense 112 725 2 14
ENSDART00000146189 Nonsense 112 322 2 3
Genomic Location:
Chromosome 3 (position 46600856)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGTGACTGAAATCTTGCTGTTTTTTTTGTAGGAGGTTCATGAGCTGT[T/A]GGGCAACTATGATTTAAAGTACTGCTTTGTGGACAAATACAAAGGAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040083 Nonsense 180 312 3 4
ENSDART00000127832 Nonsense 180 725 3 14
ENSDART00000146189 Nonsense 180 322 3 3
Genomic Location:
Chromosome 3 (position 46604520)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGACGCTCTGCTCTGCATCGCCAACCTTCCCAGGGCGTTCACTCAGCAA[C/T]AGTTCGAGGAGCTAGTTCGGCCCTTCGGAAACATTGAGCGCTGCTTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040083 None None 312 None 4
ENSDART00000127832 Splice Site, Nonsense 421 725 6 14
ENSDART00000146189 None None 322 None 3
Genomic Location:
Chromosome 3 (position 46618339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTCTCTCTGCTGCCCTGATGCAGATGCTGCTTCAGAACCAAGTCCAA[C/T]AGGTACAATGCTGACCTCTCTTTCCACCTCTTATAAACTGCCACTCTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3ss0icjt