olig4

Ensembl ID:
ENSDARG00000052610
ZFIN ID:
ZDB-GENE-030131-3580
Description:
oligodendrocyte transcription factor 4 [Source:RefSeq peptide;Acc:NP_955808]
Human Orthologues:
OLIG2, OLIG3
Human Descriptions:
oligodendrocyte lineage transcription factor 2 [Source:HGNC Symbol;Acc:9398]
oligodendrocyte transcription factor 3 [Source:HGNC Symbol;Acc:18003]
Mouse Orthologues:
Olig2, Olig3
Mouse Descriptions:
oligodendrocyte transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:1355331]
oligodendrocyte transcription factor 3 Gene [Source:MGI Symbol;Acc:MGI:2149955]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu2107 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
hu2107
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074499 Nonsense 182 244 1 1
Genomic Location (Zv9):
Chromosome 13 (position 46535183)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 45831052
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATCCTTTAGTGGGCAGCACCTCTGCTGTGTCCCACACCACCACAAAT[G/T]GAGCTCAAACTCCTCATTCTCCACCCTCCACCGGCTATCTGGGTTTTCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link