D0PNH6_DANRE

Ensembl ID:
ENSDARG00000052604
Description:
Cytoplasmatic polyadenylation element binding protein 2A [Source:UniProtKB/TrEMBL;Acc:D0PNH6]
Human Orthologue:
CPEB2
Human Description:
cytoplasmic polyadenylation element binding protein 2 [Source:HGNC Symbol;Acc:21745]
Mouse Orthologue:
Cpeb2
Mouse Description:
cytoplasmic polyadenylation element binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2442640]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24243 Nonsense Available for shipment Available now
sa19311 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11946 Essential Splice Site Available for shipment Available now
sa10624 Essential Splice Site Available for shipment Available now
sa11569 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085290   None 407 None 9
ENSDART00000092757   None 390 None 8
ENSDART00000106336 Nonsense 20 478 1 11
Genomic Location (Zv9):
Chromosome 23 (position 2147642)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2194705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCCCCGGTGAGCCCGCAGATTCCCCCGCAGCAGCAGGGCGCCTTTCTG[C/T]AGCACAGGAACAACTACAACCACCACCAGGTGAGCAGCCGTGTTCACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085290   None 407 None 9
ENSDART00000092757   None 390 None 8
ENSDART00000106336 Essential Splice Site 30 478 2 11
ENSDART00000085290   None 407 None 9
ENSDART00000092757   None 390 None 8
ENSDART00000106336 Essential Splice Site 30 478 2 11
Genomic Location (Zv9):
Chromosome 23 (position 2153556)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2200619
KASP Assay ID:
554-6177.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGGAGGTTTTTTTGATTCTATCTAACTGACCGTCCCGTCTGTCCGCA[G/T]CCCATGATGAAGCAGTCTCCGTGGGGCAGCCATCAGGGCAGCGGCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11946
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085290   None 407 None 9
ENSDART00000092757   None 390 None 8
ENSDART00000106336 Essential Splice Site 30 478 2 11
ENSDART00000085290   None 407 None 9
ENSDART00000092757   None 390 None 8
ENSDART00000106336 Essential Splice Site 30 478 2 11
Genomic Location (Zv9):
Chromosome 23 (position 2153556)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2200619
KASP Assay ID:
554-6177.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGGAGGTTTTTTTGATTCTATCTAACTGACCGTCCCGTCTGTCYGCA[G/T]CCCATGATGAAGCAGTCTCCGTGGGGCAGCCATCAGGGCAGCGGCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10624
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085290 Essential Splice Site 58 407 1 9
ENSDART00000092757 Essential Splice Site 58 390 1 8
ENSDART00000106336 Essential Splice Site 119 478 2 11
Genomic Location (Zv9):
Chromosome 23 (position 2153827)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2200890
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACATGTTTCGCACCGACAACAACAGCAACACACTGCTGCCCCTGCAG[G/A]TACCTGTGAGCGTTTCCTCAKCGAAGATATTCACATYCCTMWTGGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085290 Essential Splice Site 233 407 6 9
ENSDART00000092757 Essential Splice Site 216 390 5 8
ENSDART00000106336 Essential Splice Site 304 478 8 11
Genomic Location (Zv9):
Chromosome 23 (position 2176378)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2223441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCAAACTCTACCTGTGTGTGTCCAGYCMCACCATCAAAGACAARCCTG[T/A]GAGTCTACACACACACATACTGTATATGCACATYKTATACCTTCAACRGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link