p4hb

Ensembl ID:
ENSDARG00000052589
ZFIN ID:
ZDB-GENE-080610-1
Description:
protein disulfide-isomerase [Source:RefSeq peptide;Acc:NP_998529]
Human Orthologue:
P4HB
Human Description:
prolyl 4-hydroxylase, beta polypeptide [Source:HGNC Symbol;Acc:8548]
Mouse Orthologue:
P4hb
Mouse Description:
prolyl 4-hydroxylase, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:97464]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31506 Nonsense Available for shipment Available now
sa26724 Nonsense Mutation detected in F1 DNA During 2017
sa11106 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31506
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103124 Nonsense 84 509 2 11
Genomic Location (Zv9):
Chromosome 6 (position 19683770)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 21755301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTAAAAGCTGAAGGCTCAGATATCAGACTAGCTAAGGTAGATGCTACA[G/T]AAGAATCAGAACTTGCTCAGGAGTTTGGTGTTCGTGGGTATCCCACCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103124 Nonsense 130 509 3 11
Genomic Location (Zv9):
Chromosome 6 (position 19690270)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 21748801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGCAGCTGGTCGACAGGCTGAGGACATCGTCAGCTGGCTGAAAAAA[C/T]GAACTGGACCCGCAGCCACTACTTTAAATGATGTCATGCAAGCAGAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11106
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103124 Essential Splice Site 207 509 5 11
Genomic Location (Zv9):
Chromosome 6 (position 19701457)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 21737614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAATATCCACTGTTGCAGCCACTAATAAGTTWTACTTTTTGTCTTTCA[G/A]TTTGATGAGGGTCGAAAWACTTTCGATGGAGAGGTCAGCAAAGAAAGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link