B0UX58_DANRE

Ensembl ID:
ENSDARG00000052587
Description:
Novel protein with Zinc finger, C3HC4 type (RING finger), B-box zinc finger and SPRY domains [Source
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38367 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074472 Nonsense 7 447 1 6

The following transcripts of ENSDARG00000052587 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 4772430)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4545641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCAGGAAGCAGCTGTTAAACAGTGAAAATGGCTTCTCCAGCTGAGTA[T/G]GATTATATTTGTCCTATCTGTCGTGATATTTTCAAAGCTCCTGTTATTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link