c6ast4

Ensembl ID:
ENSDARG00000052578
ZFIN ID:
ZDB-GENE-050626-100
Description:
six-cysteine containing astacin protease 4 [Source:RefSeq peptide;Acc:NP_001020351]
Human Orthologue:
ASTL
Human Description:
astacin-like metallo-endopeptidase (M12 family) [Source:HGNC Symbol;Acc:31704]
Mouse Orthologue:
Astl
Mouse Description:
astacin-like metalloendopeptidase (M12 family) Gene [Source:MGI Symbol;Acc:MGI:3046414]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18882 Essential Splice Site Mutation detected in F1 DNA During 2015
sa27001 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa18882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074463 Essential Splice Site 137 265 6 9
ENSDART00000144341 Essential Splice Site 137 265 7 10

The following transcripts of ENSDARG00000052578 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 40028462)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCAATGTCTGTGTGACACATAAATGTTGACATTATGTTCATCTTACA[G/T]GTGCTACTCTTACGTTGGCCGTCAGGGTAATGTCCAGACAGTATCTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074463 Essential Splice Site 196 265 6 9
ENSDART00000144341 Essential Splice Site 196 265 7 10

The following transcripts of ENSDARG00000052578 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 40028282)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGACCGTGACAATCACATCCAGGTCATCTGGGAGAACATCCTTGATG[G/A]TAATGTTCAGTCACAGAACACTTTGAGGAGAGCCCATACTCTTATGTAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j2hxrlw1