arl13a

Ensembl ID:
ENSDARG00000052575
ZFIN ID:
ZDB-GENE-040426-1790
Description:
ADP-ribosylation factor-like 13A [Source:RefSeq peptide;Acc:NP_957112]
Human Orthologue:
ARL13A
Human Description:
ADP-ribosylation factor-like 13A [Source:HGNC Symbol;Acc:31709]
Mouse Orthologue:
Arl13a
Mouse Description:
ADP-ribosylation factor-like 13A Gene [Source:MGI Symbol;Acc:MGI:1921698]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14291 Essential Splice Site Available for shipment Available now
sa4572 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19093 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10478 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074455 Essential Splice Site None 409 None 10
ENSDART00000138232 Essential Splice Site 7 434 None 10

The following transcripts of ENSDARG00000052575 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 42784086)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTCTCTGGAGAAACAAACAAAAACGCATGGAKTCTGACATACTACTG[T/A]RAGTAATGAGTWTATTTAATGTCATTTTGTTGTTTAACTWCTTCATATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074455 Essential Splice Site 44 409 None 10
ENSDART00000138232 Essential Splice Site 69 434 None 10
ENSDART00000074455 Essential Splice Site 44 409 None 10
ENSDART00000138232 Essential Splice Site 69 434 None 10

The following transcripts of ENSDARG00000052575 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 42779314)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTGGACAAGGCAGGAAAAACCTCTTGCGTCAGGGGAATGTTGAGAGG[T/A]AATTTAAATGTATATCAGSTTAGCAGAAATGCTGAWTTGACTGCAGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074455 Essential Splice Site 44 409 None 10
ENSDART00000138232 Essential Splice Site 69 434 None 10
ENSDART00000074455 Essential Splice Site 44 409 None 10
ENSDART00000138232 Essential Splice Site 69 434 None 10

The following transcripts of ENSDARG00000052575 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 42779314)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTGGACAAGGCAGGAAAAACCTCTTGCGTCAGGGGAATGTTGAGAGG[T/A]AATTTAAATGTATATCAGGTTAGCAGAAATGCTGATTTGACTGCAGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074455 Nonsense 226 409 6 10
ENSDART00000138232 Nonsense 251 434 6 10

The following transcripts of ENSDARG00000052575 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 42775991)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGCCCAGAGGAAAAGGAAAGGAAGGRAAAAATTGAGAAGAGCCGGAAC[A/T]AAACTAAAGAWGAGAAGTAAGGGCTGATWAATATGTCAGTCAGGGCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u34q2qtx