cenpi

Ensembl ID:
ENSDARG00000052565
ZFIN ID:
ZDB-GENE-060810-127
Description:
Cenpi protein [Source:UniProtKB/TrEMBL;Acc:Q08C73]
Human Orthologue:
CENPI
Human Description:
centromere protein I [Source:HGNC Symbol;Acc:3968]
Mouse Orthologue:
Cenpi
Mouse Description:
centromere protein I Gene [Source:MGI Symbol;Acc:MGI:2147897]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1693 Essential Splice Site Available for shipment Available now
sa2774 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13382 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1693
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074438 Essential Splice Site 204 759 5 20
Genomic Location:
Chromosome 14 (position 42744253)
KASP Assay ID:
554-1639.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGAATTGTTTTTCACCTTAATTTAAAATRTAMAATTTTTTTCTTGC[A/G]GTGCCCTTTTATTTGCCACTTGTTATATCTTTTAACCACACGGGAACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074438 Essential Splice Site 220 759 5 20
Genomic Location:
Chromosome 14 (position 42744201)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCCTTTTATTTGCCACTTGTTATATCTTTTAACCACACGGGAACATGG[T/A]GAGTTGTTAATTATGTGGTTAATTAATTTTTAAATGTATGCGAACGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074438 Essential Splice Site 566 759 15 20
Genomic Location:
Chromosome 14 (position 42730479)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACTGCCACGTTCTTCTGCTCAACCAGACACTCGCCTTCTATGAGACGG[T/C]ACACTCCGCTATGATTAACTTAATTAACATKATGTTCTTGGCAGGGTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bbjjhrrv