si:ch211-216k22.9

Ensembl ID:
ENSDARG00000052558
ZFIN ID:
ZDB-GENE-081105-87
Description:
probable protein-cysteine N-palmitoyltransferase porcupine [Source:RefSeq peptide;Acc:NP_001119953]
Human Orthologue:
PORCN
Human Description:
porcupine homolog (Drosophila) [Source:HGNC Symbol;Acc:17652]
Mouse Orthologue:
Porcn
Mouse Description:
porcupine homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1890212]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21268 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045684 Essential Splice Site 330 442 8 12
ENSDART00000128039 Essential Splice Site 341 461 10 14
Genomic Location (Zv9):
Chromosome 8 (position 21691162)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21121059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTTCACTGCCATTATCATGACATACACAGCAAGCGCTTTGCTTCATG[T/A]AAGTGCATTTTGTGTGAATTGATTACTTCTTTTGTGGTACAACACAATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link