fgfrl1b

Ensembl ID:
ENSDARG00000052556
ZFIN ID:
ZDB-GENE-050201-3
Description:
fibroblast growth factor receptor-like 1b [Source:RefSeq peptide;Acc:NP_001012263]
Human Orthologue:
FGFRL1
Human Description:
fibroblast growth factor receptor-like 1 [Source:HGNC Symbol;Acc:3693]
Mouse Orthologue:
Fgfrl1
Mouse Description:
fibroblast growth factor receptor-like 1 Gene [Source:MGI Symbol;Acc:MGI:2150920]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2753 Essential Splice Site F2 line generated During 2014
sa10713 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2753
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074428 Essential Splice Site 115 481 2 6
Genomic Location:
Chromosome 14 (position 43169099)
KASP Assay ID:
554-2927.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAATGGATTTGGCAGCCTCGCCCTCAACTTCACACTCATAGTAATTGG[T/G]AAAGACTCCCTCCCACGCCATACACCACAACGCTTTATATCTCAATCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074428 Nonsense 300 481 5 6
Genomic Location:
Chromosome 14 (position 43137969)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAWCCGGGCTCAGAGGACCGCTATAACTYCACGCTGGAAGTTGGAGGA[C/T]AGCATTATGTGGTKTTACCCACTGRAGATGTATGGTCCAGGCCGGAYGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ccvif1ne