metrnl

Ensembl ID:
ENSDARG00000052555
ZFIN ID:
ZDB-GENE-040426-1917
Description:
Meteorin-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q7ZV46]
Human Orthologue:
METRNL
Human Description:
meteorin, glial cell differentiation regulator-like [Source:HGNC Symbol;Acc:27584]
Mouse Orthologue:
Metrnl
Mouse Description:
meteorin, glial cell differentiation regulator-like Gene [Source:MGI Symbol;Acc:MGI:2384806]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
e44 Nonsense Confirmed mutation in F2 line Unknown
sa20135 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
e44
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074430 Nonsense 46 286 2 4
Genomic Location:
Chromosome 3 (position 49640167)
KASP Assay ID:
554-0078.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTTCTTGCAGTGGACTGACCCATGAGGGACACACTCGGGATGTGGAG[C/T]AGGTGTATCTCCGCTGCGCCCAGGGGTTCCTGGAGTGGCTGTACCCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074430 Essential Splice Site 162 286 2 4
Genomic Location:
Chromosome 3 (position 49640519)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATGAGCTGGTCAACCACAGACCAGGAGCAGATCCACAGTCATTATCTG[G/A]TAAGATGTCCTCTTGATCTTTGAAGACTCGCCTGACAAGCCTGGTTTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aarj8vy3