gltpd1

Ensembl ID:
ENSDARG00000052537
ZFIN ID:
ZDB-GENE-040801-240
Description:
Glycolipid transfer protein domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6DBQ8]
Human Orthologue:
GLTPD1
Human Description:
glycolipid transfer protein domain containing 1 [Source:HGNC Symbol;Acc:28116]
Mouse Orthologue:
Gltpd1
Mouse Description:
glycolipid transfer protein domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1933107]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11213 Nonsense Available for shipment Available now
sa1471 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074407 Nonsense 28 211 1 2

The following transcripts of ENSDARG00000052537 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 37184517)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACATTCAGRTCAAGTCTGAGTGAAAATAAGGAGGTTTACATTAAATA[T/G]TACATAGCAGGATGGCAAGAGCTCGTCAGGTGAGAATTGTTTTATTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074407 Nonsense 100 211 2 2

The following transcripts of ENSDARG00000052537 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 37187247)
KASP Assay ID:
554-1396.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGAGAACGACCTGGTGGACCTCACCAAAAGAGGCAGCCATCCAGAAT[C/A]GGGTTGTCGGACTCTCCTGCGGCTCCACCGGGCTCTTCGCTGGCTGGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qorss76n