si:dkey-220f10.6

Ensembl ID:
ENSDARG00000052522
ZFIN ID:
ZDB-GENE-041111-253
Description:
sorting nexin 11 [Source:RefSeq peptide;Acc:NP_001037781]
Human Orthologue:
SNX11
Human Description:
sorting nexin 11 [Source:HGNC Symbol;Acc:14975]
Mouse Orthologue:
Snx11
Mouse Description:
sorting nexin 11 Gene [Source:MGI Symbol;Acc:MGI:1921729]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6250 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6250
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080870 Essential Splice Site 71 328 4 7
ENSDART00000105361 Essential Splice Site 71 313 4 8
ENSDART00000105362 Essential Splice Site 71 506 4 7
Genomic Location (Zv9):
Chromosome 12 (position 21966097)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 20491678
KASP Assay ID:
554-4755.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYGAGTTTGCTTGGCTGAAGAAAAAACTGCAGAAGAATGCTGGTCTGGTG[T/C]AAGTTCCTGTTTATGCTTCCAATTGAGCATGGCTACATGCACAACAGTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Epilepsy (generalized): Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32 (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link