HMHA1 (3 of 3)

Ensembl ID:
ENSDARG00000052496
Description:
histocompatibility (minor) HA-1 [Source:HGNC Symbol;Acc:17102]
Human Orthologue:
HMHA1
Human Description:
histocompatibility (minor) HA-1 [Source:HGNC Symbol;Acc:17102]
Mouse Orthologue:
Hmha1
Mouse Description:
histocompatibility (minor) HA-1 Gene [Source:MGI Symbol;Acc:MGI:1917969]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5172 Nonsense Mutation detected in F1 DNA During 2014
sa16958 Nonsense Available for shipment Available now
sa19911 Nonsense Available for shipment Available now
sa8101 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089158 Nonsense 138 1101 2 23
Genomic Location:
Chromosome 2 (position 57477290)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCAGTTATCGAGGTGGAGGACATTCCCTCTCTGCTGAGAGACGTMGCA[C/T]GATTTGCGGAGGCCGTGGAGAAACTCAAGGACATGGTGCTGGGTGAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089158 Nonsense 206 1101 4 23
Genomic Location:
Chromosome 2 (position 57450894)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACGCAGTGTGAAGTWGTTCTCTTCTCCATGTTTGTCAGGGTTCAGTTA[T/A]GAAGGCACCACTGACGCTCAGAAGAAAGACTTTGAGAAGGCCATTGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19911
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089158 Nonsense 430 1101 11 23
Genomic Location:
Chromosome 2 (position 57438253)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAACCTACGTAAGGCCCGTCAGCTGTACATGAGCCGCTGTGAGGAGTA[C/A]GAGAGAGCCAGGACGGTAGCCAATAAGGTGGAAGAGGAACAAAGCGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089158 Essential Splice Site 689 1101 16 23
Genomic Location:
Chromosome 2 (position 57425193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGAAGATTTAGAGGAGAGAGATGGTGCCATGACCCAGTTCGAACAAAG[T/A]AAGTRATCGATTACAARTCAGTTCCTWCATTTRTTTTCCTTCAGCTCAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9akziz52