pcdh18b

Ensembl ID:
ENSDARG00000052494
ZFIN ID:
ZDB-GENE-080804-1
Description:
protocadherin 18b [Source:RefSeq peptide;Acc:NP_001108571]
Human Orthologue:
PCDH18
Human Description:
protocadherin 18 [Source:HGNC Symbol;Acc:14268]
Mouse Orthologue:
Pcdh18
Mouse Description:
protocadherin 18 Gene [Source:MGI Symbol;Acc:MGI:1920423]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10255 Nonsense Available for shipment Available now
sa7396 Missense Mutation detected in F1 DNA During 2017
sa22533 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074362 Nonsense 326 1161 1 4
Genomic Location (Zv9):
Chromosome 14 (position 44410366)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 41806312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCAYATCACTCTTATTAAGAAAGTTGMCTACGAAACCACGTCTTCATA[T/A]GAAATAGATGTGCAGGCKCAGGATATGGGTCCCAACTCCATTCCAGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074362 Missense 424 1161 1 4
Genomic Location (Zv9):
Chromosome 14 (position 44410659)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 41806605
KASP Assay ID:
554-4371.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATGGGCATTTTCGCCTSCAGAAGACCTACGAGAACAACTACATGATTC[T/C]CACAAATGTGTCTCTGGACCGTGAGAAACGCTCTGAATATAGCTTGACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22533
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074362 Nonsense 455 1161 1 4
Genomic Location (Zv9):
Chromosome 14 (position 44410751)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 41806697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTGACGGTGATCGCCGAAGACCGTGGCACGCCAAGCCTATCCACCATC[A/T]AACACTTCACAGTGCAGGTGCAGGATGAAAATGACAACCCTCCCCGCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link