arhgef11

Ensembl ID:
ENSDARG00000052482
ZFIN ID:
ZDB-GENE-070604-1
Description:
rho guanine nucleotide exchange factor 11 [Source:RefSeq peptide;Acc:NP_001027010]
Human Orthologue:
ARHGEF11
Human Description:
Rho guanine nucleotide exchange factor (GEF) 11 [Source:HGNC Symbol;Acc:14580]
Mouse Orthologue:
Arhgef11
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 11 Gene [Source:MGI Symbol;Acc:MGI:2441869]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20855 Nonsense Mutation detected in F1 DNA During 2014
sa18863 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8256 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15205 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017140 Nonsense 35 1406 2 40
ENSDART00000136594 Nonsense 46 524 3 19
Genomic Location:
Chromosome 7 (position 6311663)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACTCATCTTTATATTTTCTGTTCCTCCTGATTTGACAGGAACGGGTT[T/A]GGTCCAAAGATGCGTGGTCGTGCAGAGGGACAATCTGGGGTTTGGCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017140 Essential Splice Site 226 1406 7 40
ENSDART00000136594 Essential Splice Site 237 524 8 19
Genomic Location:
Chromosome 7 (position 6301478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCCAAACGAAGAGCCAGTCAGGTCAGAGTGAAGATCCAGCAGGACGTG[G/T]TGAGGATTTGCATATTAATGATACAGCAGCTGTTGATGCATGAACTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8256
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017140 Essential Splice Site 374 1406 13 40
ENSDART00000136594 Essential Splice Site 385 524 14 19
Genomic Location:
Chromosome 7 (position 6292360)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGTCACTCGCCCCGCAGATCTGCTCACACTTCCTGGACCATGATGCTG[T/A]GCGTATCTCAACTACACCATAGTTTTCACGTGTTGTCRTATCATTAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15205
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017140 Essential Splice Site 801 1406 26 40
ENSDART00000136594 None None 524 None 19
Genomic Location:
Chromosome 7 (position 6256699)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGAATCAGTGATMGTTCAGGGCATTGGAGACATCATGCTGGCCAGAG[T/C]GAGTCTCATTTCTCTGTCTTCATCTCWGGATTTCKGTCTGTGTTGGTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5y7i6tj7