pdcd11

Ensembl ID:
ENSDARG00000052480
ZFIN ID:
ZDB-GENE-030131-4076
Description:
protein RRP5 homolog [Source:RefSeq peptide;Acc:NP_001082837]
Human Orthologue:
PDCD11
Human Description:
programmed cell death 11 [Source:HGNC Symbol;Acc:13408]
Mouse Orthologue:
Pdcd11
Mouse Description:
programmed cell death 11 Gene [Source:MGI Symbol;Acc:MGI:1341788]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10691 Nonsense Available for shipment Available now
sa8601 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9850 Essential Splice Site Available for shipment Available now
sa18706 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10691
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074342 Nonsense 416 1816 9 35
ENSDART00000108733 Nonsense 413 931 10 31
ENSDART00000124833 Nonsense 416 1816 10 36

The following transcripts of ENSDARG00000052480 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 49953986)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48803167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AMAAACCACCTGATGTCCCAGWCTCAGCATATTCTGAGGATCATAAATTA[C/A]AGTCCAATAGAGCAGATCTACCARGCCACGCTCCGCTGGTTGGTTTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074342 Essential Splice Site 1296 1816 None 35
ENSDART00000108733 Essential Splice Site None 931 None 31
ENSDART00000124833 Essential Splice Site 1296 1816 None 36

The following transcripts of ENSDARG00000052480 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 49977501)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48826682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATCAGAGGATATGTGTCGTCTGTTAACGACCAAGGCATATTTCTAAGG[T/C]AAAGTATTTGTTGATTTACATGTATTTTAATTAATTTGTTGTAATAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9850
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074342 Essential Splice Site 1513 1816 30 35
ENSDART00000108733   None 931 None 31
ENSDART00000124833 Essential Splice Site 1513 1816 31 36
ENSDART00000074342 Essential Splice Site 1513 1816 30 35
ENSDART00000108733   None 931 None 31
ENSDART00000124833 Essential Splice Site 1513 1816 31 36

The following transcripts of ENSDARG00000052480 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 49981447)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48830628
KASP Assay ID:
2259-1063.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGACGACAACCAGAACTCCAGTGAGGATGAGGAGGAAGTCAAAAGCAAG[G/A]TGAGCTCAHGTGTCAATCAAAAGCTCMATTTCTTCTGTGTAGACTTTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074342 Essential Splice Site 1513 1816 30 35
ENSDART00000108733   None 931 None 31
ENSDART00000124833 Essential Splice Site 1513 1816 31 36
ENSDART00000074342 Essential Splice Site 1513 1816 30 35
ENSDART00000108733   None 931 None 31
ENSDART00000124833 Essential Splice Site 1513 1816 31 36

The following transcripts of ENSDARG00000052480 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 49981447)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48830628
KASP Assay ID:
2259-1063.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACGACAACCAGAACTCCAGTGAGGATGAGGAGGAAGTCAAAAGCAAG[G/A]TGAGCTCAAGTGTCAATCAAAAGCTCCATTTCTTCTGTGTAGACTTTAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link