taf1a

Ensembl ID:
ENSDARG00000052471
ZFIN ID:
ZDB-GENE-041014-272
Description:
TATA box-binding protein-associated factor RNA polymerase I subunit A [Source:RefSeq peptide;Acc:NP
Human Orthologue:
TAF1A
Human Description:
TATA box binding protein (TBP)-associated factor, RNA polymerase I, A, 48kDa [Source:HGNC Symbol;Acc
Mouse Orthologue:
Taf1a
Mouse Description:
TATA box binding protein (Tbp)-associated factor, RNA polymerase I, A Gene [Source:MGI Symbol;Acc:MG

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19248 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19248
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074330 Nonsense 193 448 4 10
ENSDART00000127444 Nonsense 193 448 5 11
Genomic Location:
Chromosome 20 (position 52189751)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACGCTGATCACAGCCTACTGCGGCTTACTGGATTACTTGATCTGGAAC[G/T]AGAAGAAGTCCTCTGTGTCTGAAAACGGTAACATTTAATACACTGACATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q18ep22u