rhpn1

Ensembl ID:
ENSDARG00000052454
ZFIN ID:
ZDB-GENE-081031-79
Description:
Novel protein similar to vertebrate rhophilin, Rho GTPase binding protein 1 (RHPN1) [Source:UniProtK
Human Orthologue:
RHPN1
Human Description:
rhophilin, Rho GTPase binding protein 1 [Source:HGNC Symbol;Acc:19973]
Mouse Orthologue:
Rhpn1
Mouse Description:
rhophilin, Rho GTPase binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1098783]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31051 Nonsense Mutation detected in F1 DNA During 2017
sa43547 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074307 Nonsense 23 574 1 14
ENSDART00000135463 Nonsense 46 364 2 10
ENSDART00000074307 Nonsense 23 574 1 14
ENSDART00000135463 Nonsense 46 364 2 10
Genomic Location (Zv9):
Chromosome 20 (position 52607441)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 52455898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCGACCCAGCGCAGTAAGCTGCAGCAGCGCAGAGCCAAACTCAACCAG[C/T]AGATCAACCGAGAGCTGCTTCTGCGCAGCGGAGCTGAAAATCTCTACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074307 Nonsense 23 574 1 14
ENSDART00000135463 Nonsense 46 364 2 10
ENSDART00000074307 Nonsense 23 574 1 14
ENSDART00000135463 Nonsense 46 364 2 10
Genomic Location (Zv9):
Chromosome 20 (position 52607441)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 52455898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCGACCCAGCGCAGTAAGCTGCAGCAGCGCAGAGCCAAACTCAACCAG[C/T]AGATCAACCGAGAGCTGCTTCTGCGCAGCGGAGCTGAAAATCTCTACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link