cryabb

Ensembl ID:
ENSDARG00000052447
ZFIN ID:
ZDB-GENE-040718-419
Description:
crystallin, alpha B, b [Source:RefSeq peptide;Acc:NP_001002670]
Human Orthologue:
CRYAB
Human Description:
crystallin, alpha B [Source:HGNC Symbol;Acc:2389]
Mouse Orthologue:
Cryab
Mouse Description:
crystallin, alpha B Gene [Source:MGI Symbol;Acc:MGI:88516]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33728 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060989 Essential Splice Site 97 165 2 3
ENSDART00000122492 Essential Splice Site 44 112 2 3
Genomic Location (Zv9):
Chromosome 5 (position 58993193)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 56973775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCATTGGAGATTTCATTGAAATTCATGCTAAACATGAAGATCGTCAG[G/A]TAGCCTACTGTTATCTTACAGTTCACAGTAACCCAAAACCTCAAAGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link