actr2

Ensembl ID:
ENSDARG00000052438
ZFIN ID:
ZDB-GENE-040426-2894
Description:
Actin-related protein 2-A [Source:UniProtKB/Swiss-Prot;Acc:Q7SXW6]
Human Orthologue:
ACTR2
Human Description:
ARP2 actin-related protein 2 homolog (yeast) [Source:HGNC Symbol;Acc:169]
Mouse Orthologue:
Actr2
Mouse Description:
ARP2 actin-related protein 2 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1913963]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19596 Essential Splice Site Available for shipment Available now
sa19597 Nonsense Mutation detected in F1 DNA During 2016
sa39692 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074294 Essential Splice Site 126 394 4 9
Genomic Location (Zv9):
Chromosome 1 (position 51926365)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50773726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGACTGATCATCTGTGAAGTGTGTGTTGACCCTCTTGTCTCCCTGTA[G/A]GTGATGTTTGAGACCTATCAGTTCTCTGGAGTTTATATCGCCATCCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074294 Nonsense 131 394 4 9
Genomic Location (Zv9):
Chromosome 1 (position 51926383)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50773744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTGTGTGTTGACCCTCTTGTCTCCCTGTAGGTGATGTTTGAGACCTA[T/A]CAGTTCTCTGGAGTTTATATCGCCATCCAGGCCGTCCTTACACTCTACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074294 Nonsense 303 394 8 9
Genomic Location (Zv9):
Chromosome 1 (position 51930662)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50778023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTTTGTCTGTCTTGATCTAAGGGCTGAGTTTTACAAGCACATTGTTT[T/A]GTCGGGCGGCTCCACCATGTATCCCGGTCTGCCGTCTCGTCTGGAGCGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link