actr2

Ensembl ID:
ENSDARG00000052438
ZFIN ID:
ZDB-GENE-040426-2894
Description:
Actin-related protein 2-A [Source:UniProtKB/Swiss-Prot;Acc:Q7SXW6]
Human Orthologue:
ACTR2
Human Description:
ARP2 actin-related protein 2 homolog (yeast) [Source:HGNC Symbol;Acc:169]
Mouse Orthologue:
Actr2
Mouse Description:
ARP2 actin-related protein 2 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1913963]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19596 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19597 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19596
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074294 Essential Splice Site 126 394 4 9
Genomic Location:
Chromosome 1 (position 51926365)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGACTGATCATCTGTGAAGTGTGTGTTGACCCTCTTGTCTCCCTGTA[G/A]GTGATGTTTGAGACCTATCAGTTCTCTGGAGTTTATATCGCCATCCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074294 Nonsense 131 394 4 9
Genomic Location:
Chromosome 1 (position 51926383)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTGTGTGTTGACCCTCTTGTCTCCCTGTAGGTGATGTTTGAGACCTA[T/A]CAGTTCTCTGGAGTTTATATCGCCATCCAGGCCGTCCTTACACTCTACGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2unzgvpw