hrh1

Ensembl ID:
ENSDARG00000052425
ZFIN ID:
ZDB-GENE-070531-3
Description:
histamine H1 receptor [Source:RefSeq peptide;Acc:NP_001036196]
Human Orthologue:
HRH1
Human Description:
histamine receptor H1 [Source:HGNC Symbol;Acc:5182]
Mouse Orthologue:
Hrh1
Mouse Description:
histamine receptor H1 Gene [Source:MGI Symbol;Acc:MGI:107619]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41753 Nonsense Mutation detected in F1 DNA During 2017
sa21825 Nonsense Available for shipment Available now
hu3427 Nonsense Confirmed mutation in F2 line Unknown
sa38817 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41753
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074283 Nonsense 405 534 1 1
Genomic Location (Zv9):
Chromosome 11 (position 892637)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 874584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGGGGAACATCTGCGAGAGTGCGCCGACTGTAGATATCCATAATTA[C/A]ACCGCAGTTCTGTGTACGCCACCTTCGCCGCCGTCTCCGTGGGCTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21825
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074283 Nonsense 444 534 1 1
Genomic Location (Zv9):
Chromosome 11 (position 892522)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 874469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCTAGTATTGCGCTACCTGCGAAGCAATCATGGCAGAAACTCTGCGAA[C/T]AATCCAAGCAGAGCATTCACAGCATGCGCATCCGCAAGGAGAGGAAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3427
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074283 Nonsense 456 534 1 1
Genomic Location (Zv9):
Chromosome 11 (position 892486)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 874433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACTCTGCGAACAATCCAAGCAGAGCATTCACAGCATGCGCATCCGC[A/T]AGGAGAGGAAAGCGGCGCGCCAGCTGGGCTTTATCATCGGCGTCTTCATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa38817
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074283 Nonsense 524 534 1 1
Genomic Location (Zv9):
Chromosome 11 (position 892282)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 874229
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCACGCTCAATCCCTTCATTTACCCGCTCTGCAACGAAAACTTCAAA[C/T]GAGTGTTCAAGAAGATCTTTCATATGAGTAGATAGAGTTGTGAAGAGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link