mypt2

Ensembl ID:
ENSDARG00000052423
ZFIN ID:
ZDB-GENE-010724-11
Description:
protein phosphatase 1 regulatory subunit 12C [Source:RefSeq peptide;Acc:NP_001071047]
Human Orthologues:
DYSFIP1, NRARP, PPP1R12C
Human Descriptions:
dysferlin interacting protein 1 [Source:HGNC Symbol;Acc:16813]
NOTCH-regulated ankyrin repeat protein [Source:HGNC Symbol;Acc:33843]
protein phosphatase 1, regulatory (inhibitor) subunit 12C [Source:HGNC Symbol;Acc:14947]
Mouse Orthologues:
Dysfip1, Nrarp, Ppp1r12c
Mouse Descriptions:
dysferlin interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1915951]
Notch-regulated ankyrin repeat protein Gene [Source:MGI Symbol;Acc:MGI:1914372]
protein phosphatase 1, regulatory (inhibitor) subunit 12C Gene [Source:MGI Symbol;Acc:MGI:1924258]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2329 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20692 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074256 Essential Splice Site 152 672 4 21
ENSDART00000136019 None None 123 None 3
ENSDART00000141673 None None 139 None 6
ENSDART00000145181 None None 133 None 6
Genomic Location:
Chromosome 6 (position 23299399)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACTCCCCTTCATGTGGCTGCGTCCTGTGGAAACCTGGAGATAGCAGAG[T/A]ATGTTATGGATGACTTTTTATATGTATATTTTTAGTAGGGCTGGGCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074256 Nonsense 324 672 9 21
ENSDART00000136019 None None 123 None 3
ENSDART00000141673 None None 139 None 6
ENSDART00000145181 None None 133 None 6
Genomic Location:
Chromosome 6 (position 23287211)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTAGTATTAATTTTGTGTCTGTTTATTTTAGTGGAGGACTGAACAA[C/T]AAAATTCACAGACATCAAATGTCAATCCTGCAAACAAAAAACGCAGGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a7c1i2ez