mypt2

Ensembl ID:
ENSDARG00000052423
ZFIN ID:
ZDB-GENE-010724-11
Description:
protein phosphatase 1 regulatory subunit 12C [Source:RefSeq peptide;Acc:NP_001071047]
Human Orthologues:
DYSFIP1, NRARP, PPP1R12C
Human Descriptions:
dysferlin interacting protein 1 [Source:HGNC Symbol;Acc:16813]
NOTCH-regulated ankyrin repeat protein [Source:HGNC Symbol;Acc:33843]
protein phosphatase 1, regulatory (inhibitor) subunit 12C [Source:HGNC Symbol;Acc:14947]
Mouse Orthologues:
Dysfip1, Nrarp, Ppp1r12c
Mouse Descriptions:
dysferlin interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1915951]
Notch-regulated ankyrin repeat protein Gene [Source:MGI Symbol;Acc:MGI:1914372]
protein phosphatase 1, regulatory (inhibitor) subunit 12C Gene [Source:MGI Symbol;Acc:MGI:1924258]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20692 Nonsense Mutation detected in F1 DNA During 2016
sa40683 Nonsense Mutation detected in F1 DNA During 2016
sa31509 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074256 Nonsense 324 672 9 21
ENSDART00000136019   None 123 None 3
ENSDART00000141673   None 139 None 6
ENSDART00000145181   None 133 None 6
Genomic Location (Zv9):
Chromosome 6 (position 23287211)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19542657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTAGTATTAATTTTGTGTCTGTTTATTTTAGTGGAGGACTGAACAA[C/T]AAAATTCACAGACATCAAATGTCAATCCTGCAAACAAAAAACGCAGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074256 Nonsense 516 672 15 21
ENSDART00000136019   None 123 None 3
ENSDART00000141673   None 139 None 6
ENSDART00000145181   None 133 None 6
Genomic Location (Zv9):
Chromosome 6 (position 23282434)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19537880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTCTCCCTGCATTAGACACTGATCCGGAGAGGGAATCTTTAGAGGCA[C/T]AAACAAAACTAGGAGTGAGAGATCGCAGAAAAGGGAGGAAAGAGAGACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31509
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074256 Essential Splice Site 559 672 16 21
ENSDART00000136019   None 123 None 3
ENSDART00000141673   None 139 None 6
ENSDART00000145181 Essential Splice Site 38 133 2 6
Genomic Location (Zv9):
Chromosome 6 (position 23282113)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19537559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGATGATATGGATGCAAATGAAGATGCACAACAAGACAACAATGCAAG[G/A]TTTGATATGTTAATGTTTGTGTGCATGCGCACGTGTTTGTGTGTGTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link